Homologus/ Analogous

 The two species that I’ve chosen that poses a homologous trait are the Blue Whale and the Gorilla. The Blue Whale is a marine mammal and the largest animal ever known to have existed measuring at approximately 108 ft.  long and weighing in at about 200 tons. The Gorillas are the largest species of primates, whose closest relatives are chimpanzees and humans, and natural habitats consist of the tropical/ subtropical forests of Africa.

The homologus trait that they both share is the flipper of the Blue Whale and the arm of the Gorilla. The Gorilla arm and the Blue Whale fin are structured similarly; the humerus bone is attached to the radius and ulna bones which are connected to the carpals, metacarpals and phalanges, however the function of these arms are used differently by both species. The Blue Whales flipper is short, flat and paddle shaped and is used to help them move through the water and keep them balanced. The Gorillas arm is long, large and muscular because Gorillas use them as walking limbs although they are capable of walking upright. Although the limbs of both species are superficially different, the underlying structure is very similar.

Both of these mammals inherited their limbs and evolved from a common ancestor, which was the first Tetrapod, which existed around 350 million years ago. We know that Tetrapods possessed limbs due to many fossils that have been discovered. From here we see that the tetrapod evolved to land walking creatures that future species would later use this limb as an arm to grasp and hold objects and the other creatures went towards the ocean and used them as tools to help them navigate through water.

The two species that I have chosen that share an analogous trait is the Bottlenose Dolphin and the Great White Shark. The Bottlenose Dolphin is a mammal that resides in the ocean in warm temperate waters and is known for considerable intelligence.  The Great White Shark is a large shark that resides in most major oceans and can be found in coastal surface waters, mostly known for its size and association with Steven Spielberg’s film Jaws.

The analogous trait that they both possess is the ‘tail’. The Bottlenose Dolphins tail is called a fluke and the Great White Sharks are called the caudal fin, both are used to propel themselves throughout water. In the Great White Sharks case the caudal fin is vertical and it is used side to side whereas the Bottlenose Dolphin has a horizontal fluke and it moves up and down. Both tails thrusts the species through the water with considerable force and speed allowing them to accelerate and move through waters quickly. The tails of both species are used for the same purpose and are similar in appearance.

The possible common ancestor that theses species have is the Myllokunmingia, which is believed to be the first vertebrae, which was in existence about 524 million years ago. From here, evolution from these beginnings lead to the species we are familiar with today such as bony fishes, birds, frogs and mammals. Skeletal elements of the animal suggest that it had a skull a long dorsal fin. This was not at all like what the Bottlenose Dolphin and Great White shark have today put the rear tip of the animal was used similarly (to thrust and glide through water) to the species which we’ve compared.

Can you break the code?

Translate the DNA strand into mRNA to 'break the code'.

I've included the codon chart below to help you transcribe the secret message.

GOOD LUCK!!!

TTAGTACCACGAGGCAAGCTCCAGTCCCAAATTGTCTATCGATT

Malthus' Imprint on Darwin's Natural Selection

Thomas Malthus and his theory regarding the Principle of Population have arguably had the most influential effect on Charles Darwin. Darwin has even noted Malthus in his writings, The Variations Of Animals and Plants under Domestication where he states ‘...I saw, on reading Malthus on Population, that natural selection was the inevitable result of the rapid increase of all organic beings...’. Here he took the basic concept of Malthus’ theory and used it as the foundation for his Natural Selection Theory. By expanding on Malthus’ principle, Darwin found the underlying motive of evolution through natural selection, which is the biological need to compete in our species, as in others.

In 1798, ordained minister and economist, Thomas Malthus published his theory in pamphlet form, Essay On The Principle Of Population, where he argued that the natural food supply available would not support the rapid growth rate of our population. Malthus explained that human population would increase two times fold and described it mathematically as follows (1,2,4,16,32,64,128,256…), whereas agricultural growth would only increase as (1,2,3,4,5,6,7…). The obvious problem here lies within our biological need to reproduce not being in sync with the amount of food supplies necessary to sustain this growth. His Christian background merged with his scientific theory with the presentation of his ‘positive checks’ which he described as starvation and diseases, which were God implemented, in order to maintain population control.

http://geography.about.com/od/populationgeography/a/malthus.htm

This precise theory is what Darwin needed to explain the reasoning behind interspecies competition. The limited resources available encourage healthy struggles among members of the same species, where the more able specimens secure better access to these resources. This enables them to reproduce with other successful specimens of the same species. The pairing of these two organisms and their beneficial traits, produce these offspring of shared genetic material, who then have even higher chances to access limited resources. Over time and generations of selective breeding, passing down beneficial genetic traits, the species as a whole will have evolved into organisms better adapted to their environment.

Darwin could have not developed his theory of Natural Selection without the basis of meaningful competition that Malthus’ Principles of Population theory provided. From Malthus’ theory, Darwin concluded that through the fight for survival, the best equipped organisms would survive and those less environmentally adaptive would eventually die out as they would be unable to thrive attaining necessary resources nor reproducing. Therefore, only the specimens with these advantageous traits would flourish and reproduce which is the basis of Darwin’s Natural Selection theory.

During the time period of Darwin and the progression of his Natural Selection Theory, it was well understood that God created the world and all of its creatures within 7 days, as the Bible professes. Darwin’s controversial concept in, On the Origin of Species by Means of Natural Selection, suggested that man was comparable to any other animal (not superior in design, origin or meaning) and a creation of evolution, even worse a possible outcome of the evolution of apes. Such an idea went against all conventional thinking at the time and questioned the foundation on which the Bible is based, the creation of man by God. His theory was met with huge attacks from the Church, which was a partial reason for the prolonged release of his studies. In time, Darwin’s theory gained regard within unorthodox groups such as atheist and certain publications like The Times.

Charles Darwin’s contribution to the world of science is vast and immeasurable, but one must give credit where credit is due and without the influence of Thomas Malthus and his Principle of Population, the Darwin’s theory of Natural Selection might have not come to be.